Haplogroup G2c (Y-DNA)

(הועתק מהויקיפדיה האנגלית)

הגן היהודי - תרגום אוטמטי

In human genetics, Haplogroup G2c (formerly G5) is a Y-chromosome haplogroup and is defined by the presence of the M377 mutation. It is a branch of Haplogroup G, which in turn is defined by the presence of the M201 mutation.

G2c is a major Y chromosome haplogroup, and yet unique: It has a very high frequency in Ashkenazi Jews, and shows strong evidence of a very recent settlement in Europe. (See also page covering Jews with Haplogroup G (Y-DNA)). The TMRCA (time until most recent common ancestor) appears to be around 1100 CE for this close group of Ashkenazi Jews. It is rare outside of northern Europe but there is recent evidence that this haplogroup is also found in certain Lebanese Christian populations originating from southern Syria and it has been found in a single Turk from Kars Province in Turkey on the border with Armenia, a Pashtun from the area of Pakistan bordering Afghanistan in the Hindu Kush range, and a single Burusho from the Hunza Valley in the Karakorum Range in Kashmir. Recently, it was discovered that an Egyptian and a Jordanian have values very similar to the Lebanese G2c group. It is confirmed that a sample from Sicily was G2c and the common ancestor between the Jewish group and this lone Sicilian match up to the time Titus brought the Jews out of Judea. This Jewish group could very well be Italkim Jews (Italian Jews); which would explain why it was never found amongst Sephardi Jews (those with origins in Spain or Portugal) and would explain it's rather late arrival into Eastern Europe.

G2c presents more mysteries regarding its origin and distribution than virtually any other major Y haplogroup. Haplogroups that are rare in certain regions are more common in another, and have rather clear origins in other places where they are more commonly found. G2c has none of these obvious characteristics. It is most common by far in a region where it arrived very recently, but rare in other region including its likely area of origin. The distribution of G2c is sparse and dispersed, with almost no G2c haplotypes found in very large intervening regions. This pattern is unique among Y haplogroups.

Phylogenetic position

Extensive single nucleotide polymorphism (SNP) testing by the Haplogroup G SNP project found that G2c is an independent branch of haplogroup G characterized by only one SNP, M377. A forthcoming study by the Y Chromosome Consortium at the University of Arizona found that within haplogroup G, G2c and G2 share a new SNP, P287, which is not found in the other well-attested branch of G, haplogroup G1. As a result, it will be proposed that Haplogroup G5 be renamed "G2c".

Recent changes to the phylogeny are listed in red.

G

G*      G1 (M285,M342)      G1*       (P20)     G1a       (P76)     G1b [new]      G2 (P287) [new G2]      G2* [new]      G2a (P15, L31 = S149) [old G2]      G2a* [old G2*]      G2a1 (P16) [old G2a]      G2a1* [old G2a]          (P18)         G2a1a [old G2a1]      (M286)      G2a2 [old G2b]      G2a3 (L30 = S126, L32 = S148 = U8) [new]      G2a3* [new]      G2a3a (M406) [new]      G2a3a* [new]         (L14 = S133) G2a3a1 [new]              G2a3b (P303) [new]      G2a3b1 (U1 = S135)  [new]              G2a3b1* [new]         (L13 = S131 = U13) G2a3b1a [new]         (S147, S148) G2a3b2a [new]              (M287)      G2b [old G3]      (M377)      G2c* [old G5]      (M283) [new]      G2c1 [new]

Haplogroup G SNP reference table

Ref SNP ID	Ethnoancestry	Family Tree DNA	G SNP Project
rs35160044			G2
rs34134567	S126	L30	U8
rs35474563	S130	L14	U16?
rs9786706	S131	L13	U13
rs9786246	S132
rs35169834	S133
rs34977142	S134		U16?
rs9786316?	S135		U1?
rs34334142	S146
rs35251548	S147
rs7892988	S148	L32
rs35617575	S149	L31

Haplogroup characteristics

Distinguishing Y-STR alleles

For the full listing of all the G2c Y-STR modal haplotype values, see the entry:
HRGEN in ySearch.org

All G2c samples tested so far have a null value for the DYS425 marker, (a missing "T" allele of the DYS371 palindromic Y-STR, the result of a RecLOH event. This change is extremely uncommon in the rest of haplogroup G, but apparently happened early in the history of G2c.

G2c Y-STR distinguishing allele values

Y-STR	Allele range	Modals
DYS393	12-13	13
DYS390	23-24	23
DYS19	15-17	15 17
DYS391	10-12	10 11
DYS385*	13,15 13,16 13,17 14,16	13,16
DYS426	11
DYS388	12
DYS439	11-12	11
DYS392	11
DYS389	13,29 13,30 13,31 14,31 14,32 14,33 15,33	13,30 14,31 14,32
DYS459	8,9
DYS464	13,13,14,15 13,13,15,15 13,14,14,15 13,14,15,15	13,14,15,15
DYS607	15-17	16
DYS395S1a	16,16
DYS425	null
DYS413	21,22
DYS436	11
DYS481	19
DYS461	12

* In haplogroup G2c, according to the Kittler Protocol for DYS385 which tests for the actual order of the DYS385 alleles along the Y chromosome, the smaller allele precedes the larger and therefore the allele sequence given here is physically correct.

Primer sequence

SNP name	gene	gene location	Y position
M377	DDX3Y	intron 10	15,536,827
		Primer (5'→3')
position (bp)	SNP	forward	reverse	length (bp)
40	A→T	tatgcatttgttgagtatatgtc	gttctgaatgaaagttcaaacg	326

Distribution

Ashkenazi Jews

A cluster of closely related Ashkenazi Jews represent virtually all confirmed G2c persons worldwide, both from private testing, and from academic studies. Of 211 known European G2cs, 8 are known to have non-Jewish patrilineal ancestors. G2c makes up about 7% of all Ashkenazi Jewish Y chromosome haplotypes, as was found in Behar et al. (2004) (n=442, GxG2=33). In the supplemental data from Behar et al. (2004), among the Ashkenazi Jewish G haplotypes haplotypes 4 and 6-15 are G2c, 2,3,5 are G1, and the haplogroup of the first listed is unclear. A much smaller group of Ashkenazi Jews however are in haplogroup G1, so not all GxG2 Ashkenazi Jews in the above study would be G2c. In a sample of 955 haplogroup G haplotypes, there are 103 Ashkenazi G2cs and 14 Ashkenazi G1s. The ratio of G2c:G1 among Ashkenazi Jews is approximately 10:1.

• European G2c comparative haplotype table
• European G2c unique haplotypes
• G2c SMGF.org haplotype search

Eastern Europe

The distribution of G2c in Eastern Europe very closely reflects the 16th and 17th century settlement patterns of Ashkenazi Jews in the Polish-Lithuanian Commonwealth:

Map of the partition of the Kingdom of Poland and the Grand Duchy of Lithuania from 1799. The full extent of the Polish-Lithuanian Commonwealth before partition in 1765 closely matches the distribution of G2c in Eastern Europe. The areas in this map colored yellow were taken by Prussia, those colored green were taken by Austria, and those colored pink by Russia.

Western Germany

G2c is also found among Ashkenazi Jews from Western Germany. Jews were not allowed to reside in most parts of Germany in the 16th and 17th centuries, aside from the Frankfurt Jewish Ghetto. Jews were expelled in 1670 from Vienna and the Archduchy of Austria. After Khmelytsky's Pogrom in Poland in 1648, there began a migration of Jews from Poland and Lithuania to Western Germany, which accelerated and continued into the 19th century. It isn't clear at this point whether German Jewish G2cs represent an independent settlement, or the result of a migration from Eastern Europe (although there is some evidence for the latter).

Southern Italy and Sicily

Among Europeans, there are a few significant exceptions to this almost exclusive Ashkenazi Jewish distribution - out of 211 known European G2cs, there are 4 Sicilians, including 3 members of one family with a tradition of Jewish patrilineal descent from 16th century Sicily.

Southwest Syria

It appears as if there are a few individuals of Syrian descent that also share this haplogroup. However, their split from the rest of the group should be a minimum of 2,000 years with further testing. It appears as if this group will fall into the G2c* group and not the G2c1 group with the Pashtuns. תבנית:Reference necessary

Eastern Anatolia

A confirmed G2c Y-STR haplotype found in the literature is haplotype 54 from a study of Anatolian Y chromosomes (n=523) by Cinnioglu et al. (2004) which was found in Eastern Turkey, in the city of Kars, very close to Armenia.

The Hindu Kush and Kashmir (Pakistan)

קובץ:Major ethnic groups of Pakistan in 1980.jpg

Map of the distribution of the major ethnic groups in Pakistan and Afghanistan, with the Pashtun areas shaded in green.

There are just two other confirmed G2c samples that have been publicly reported in the academic literature so far, one Pashtun in the Khyber Pakhtunkhwa province of Pakistan (the Hindu Kush Range), and one Burusho in the Hunza Valley in Kashmir. These two G2cs are Y-STR haplotypes 731 and 794 from Table 3 in the study by Sengupta et al. (2006) of Indian (n=728), Pakistani (n=176), and East Asian (n=175) Y chromosome lineages. Firasat et al. (2007) found 1 G among 97 Burushos, and in Sengupta et al. (2006) the only Burusho G was G2c, making it likely that this single G is G2c as well. The YHRD European forensic database has several haplotypes from Pakistan that are very likely to be G2c, including 1 Burusho (n=94) and 5 Pashtuns (n-93).

Hunza

קובץ:KKH.png

Map showing the Karakorum Highway, which passes through the main towns of Hunza, Baltit and the capital of Hunza Karimabad (formerly Baltit), and follows the route of the southern Silk Road.

Hunza was an important stop on the Silk Road from the Near East to China. The fertile Hunza Valley was the last resting point before the Khunjerab Pass (el. 4693 m./15397 ft.) which was the highest point on the southern route of the Silk Road from Iran, the Indian Ocean ports of the Makran Coast in Pakistan, to the Kashgar oasis in the Gobi Desert of western China. Among the Burusho South Asian Y haplogroups predominate, but there are some representatives of Central Asian (C3) and East Asian (O3) haplogroups as well. Sengupta et al. (2006) found the Burushos to be completely lacking in haplogroup G2a which is well-represented among the nearby Kalash and Pashtun populations.

Historical background of the Ani region

קובץ:83principality-taykc.gif

Map of the region of northwestern Greater Armenia which included the Medieval capitals of Bagaran (884-928), Kars (929-961) and Ani (962-1045), showing the relationship to the Georgian Bagratid Principality of Tayk during the time of the greatest expansion of the Khazar Empire (780 - 1000 CE), and the Second Golden Age of Armenia (862-977). At no time was this region under Khazar rule nor did it border on the Khazar Empire.

In 894 CE, the Bagratid Prince Ashot I was given the title of King of Armenia by the Abbasid Caliphate and briefly established his capital at the ancient Armenian center of Bagaran 40 km south of Ani, and then moved it to Shirakavan, 15 km northeast of Ani. In 929 the capital was transferred to Kars, 42 km west of Ani, and then in 969 to Ani itself. Ani in the 10th and 11th centuries had a population as high as 100,000 - 200,000. The city continued to flourish even after the capture of Ani in 1064 by the Seljuks under Alp Arslan, and the subsequent rule by the Kurdish Muslim Shaddadid dynasty from 1072-1199. In 1199 Ani was captured by the forces of Queen Tamar of Georgia and a Georgian vassal kingdom was created which was ruled by the Zakarid dynasty. In 1236, the Mongols captured Ani, killing many of its inhabitants, but afterward it was continued to be ruled by the Georgian Zakarids. After its capture by the Turkic Kara Koyunlu in the 1330s, Ani declined rapidly. The Kara Koyunlu moved their capital to Yerevan in 1446 and by the 18th century Ani had been completely abandoned.

There is no evidence that Ani or the adjacent areas ever had a Jewish population in the Medieval period. There may have been an early presence of Jews in the Kingdom of Armenia in late Hellenistic and Roman times before the conversion of Armenia to Christianity, However, the possible presence of G2c almost exclusively in the region of the Medieval capitals of Armenia, Bagaran, Shirakavan, Kars, and Ani would indicate that, if indeed these haplotypes are G2c, it appeared in Armenia no earlier than 802 CE and no later than the mid-14th century.

Other predicted G2c Jewish haplotypes

Two possible G2c Y-STR haplotype samples in the literature are from the study of Jewish and non-Jewish Near Eastern Y chromosomes by Nebel et al. (2001) (in the Appendix Table A1), haplotype 51 which was found in 1 Ashkenazi Jew (n=79) and 3 Kurdish Jews (n=99), and haplotype 47 which was found in 1 Iraqi Jew (combined Iraqi Jews n=20 and Syrian Jews n=3). However, recently advancements in haplogroup prediction have determined these haplotypes G2c. These also belong to what was termed at the time "Haplogroup 2", (F*,G, and I) and within this set of haplogroups these display a Y-STR allele pattern unique to haplogroup G2c. In this study, G2c was found among 3% of Kurdish Jews. However, as with the Armenians, there are some G2 haplotypes that appear similar to G2c at these 6 STRs, but not at DYS389.

Upcoming studies

Other Y chromosome samples taken from an upcoming study of Sephardi and Near Eastern (Mizrahi) Jews have found only a few GxG2 (in Y chromosome haplogroup G but not in G2) samples. Preliminary indications are that in this study, only a single Turkish Jew matches the any of the modal haplotypes for G2c, however, all of these samples are being tested for M377/G2c.

The Kurdish and Iraqi Jewish samples from Nebel et al. (2002) are also being tested for M377/G2c by a different group for another study. Y chromosome haplogroup G1 is also found among Jewish populations, but it is likely that some of these samples will turn out to be in haplogroup G2c.

Comparison of regional haplotypes

Population and Location	n	Status	DYS393	DYS390	DYS19	DYS391	DYS385	DYS426	DYS388	DYS439	DYS392	DYS389	DYS438	DYS461 = add 2 to DYSA7.2
Ashkenazi Jews Poland-Lithuania Western Germany Sicilians	300	confirmed	12 13	22 23 24	15 16	9 10 11	13,15 13,16 14,16	11	12	11 12	11	13,30 13,31 13,32 13,33 14,31 14,32 14,33 15,33	10	12
Turkey Kars	1	confirmed	13	23	16	10		11	12	11	11	13,29
Pathans	1	confirmed	13	23	16	11	13,16	11	12	11	11	13,30
Pathans	6	confirmed	13	23	17	10		11	12	11	11	13,30		12
Burusho Hunza Valley	1	confirmed	13	23	17	11		11	12	11	11	13,30		12
Greek Athens	1	unlikely	13	23	16	11	13,16				11	13,31
Syrians	2	unlikely	13	23	16	11	14,16 14,15				11	13,30
Iranian Tehran	1	unlikely	13	23	17	10	13,16				11	13,29
Iraqi Jew	1	predicted G2c	13	23	15	11		11	12		11
Armenians The Ani region Nagorno-Karabakh	5	predicted G2c	13	23	15	10		11	12		11
Kurdish Jews	3	predicted G2c	13	23	15	10		11	12		11

Time to the Most Recent Common Ancestor (tMRCA)

The time to the Most Recent Common Ancestor (tMRCA) for European G2c, derived by generating a median-joining network of over 25 haplotypes with 67 Y-STRs, yields a date of 955 years from the average birth year of the testees (estimated to be 1950), with a standard deviation of 107 years. The mutation rate used is based on that of family groups with known most recent common ancestors. So far, this tMRCA includes all groups of European G2cs, including it seems from preliminary evidence, the Italians.

This late tMRCA date for all of G2c in Europe raises the question of when G2c first entered Europe. If G2c entered Europe at an earlier period, we would expect to see more divergent haplotypes than we currently see. The very unusual highly ethnically-specific distribution of G2c in Europe combined with the very late tMRCA raises the question of from where G2c could have entered Europe. Also, was the spread of G2c in Europe from the Kingdom of Poland to Germany and Italy, from German to Italy and Poland, or Italy northward to both other areas? No one particular region seems to be more divergent than any other, and in fact, there doesn't seem to be any geographically correlated subclades within European G2c, with samples from each region matching some from other regions more closely than ones from the same region.

Possible history

Sicily

ראו גם:יהדות סיציליה

The most plausible scenario for the spread of G2c within Europe is an origin among Jews in Sicily, and a spread northward to Germany and the Polish-Lithuanian Commonwealth at the time of the expulsion of the Jews of Sicily in 1492.|date=April 2010

It is estimated that Jews made up 6% or more of the population of Sicily in 1492. Historical evidence shows that most Sicilian Jews went eastward to the Ottoman Empire, where Sicilian Jewish congregations existed in Salonika and Constantinople until the late 19th century. However, it is known that many Sicilian Jews first went to Calabria, and then Jews were expelled from Calabria in 1524, and later from the entire Kingdom of Naples in 1540. Thre was a gradual movement throughout the 16th century of Jews in Italy from south to north, with conditions worsening for Jews in Rome after 1556 and Venice in the 1580s. Many Jews from Venice and the surrounding area migrated to Poland and Lithuania at this time.

In this scenario it may be that there was a direct migration from Sicily or Southern Italy separately to both Western Germany and Poland-Lithuania, but the presence of G2c in Germany may be due to a later migration from Eastern Europe to Germany starting with the aftermath of Khmelnytsky's Pogrom in Poland in 1648,

Jews had lived in Sicily since Roman times. After the Byzantine reconquest of Sicily from the Arian Ostrogoths who were very tolerant of the Jews in 552, conditions worsened dramatically for Jews in Sicily. Under the Byzantine Empire few Jews lived in Sicily because of official persecution. Before 606 the bishop of Palermo ordered the synagogue to be converted into a church. An edict issued by Leo III the Isaurian in 722 which ordered the baptism by force of all Jews in the Empire. After the Muslim conquest of Sicily in 831-902, large numbers of Jews settled on the island. In 972, the Arab merchant Ibn Hawqal mentioned a Jewish Quarter in Palermo, and by 1170, Benjamin of Tudela reported 1500 Jewish households in Palermo and 200 in Messina. In 1149, Roger II forcibly brought the Jewish brocade, damask, and silk weavers of Thebes in Greece to Sicily to establish a silk industry there. This is an example of a late entry into Sicily of non-Iberian, non-Provençal Jews from outside of Western and Central Europe, from a region that has been poorly tested or devoid of Jews in modern times.

The preliminary conclusions from this evidence is that haplogroup G2c is not native to Europe. The very late tMRCA, and the very high ethnic specificity indicate a rather brief presence in Europe, but one that participated in the exponential growth of the Ashkenazi Jewish population in Eastern and Central Europe after the Black Death. The complete lack of G2c in Iberia and also so far among Spanish Jews indicates that G2c didn't come from Spain, or France, since some Spanish Jewish families originated in southern France and migrated to Spain after France expelled the Jews in 1306. This, along with the other evidence, leaves Sicily as the European origin of G2c. We know that Greek and Mizrahi Jews arrived in Sicily as late as 1149,and that primarily most Sicilian Jews settled there during the Arab Emirate of Sicily. This is one way of explaining the very late presence of G2c in Europe, the likely presence of G2c among at least Kurdish Jews, if not other Mizrahi Jews as well.

The East - the Pathans and the Burushos

The presence of G2c in the these areas may be accounted for by several several separate theories, each with their own time scale. It does seem very likely that G2c originated in the Near East, in Anatolia or Syria, and spread both eastward and westward from there.

One often stated idea is of a direct Israelite ancestry for the Pashtuns as a whole. The Israelite origin of all the Pashtuns is contradicted by the ancient sources, and also by the Iranian linguistic affiliations of the Pashto language. These stories were disseminated in Medieval times for religious reasons, and as part of the competition between the Mughals and the Pashtuns. However, this does not negate a possible Medieval Jewish origin for some of the Pashtun sub-tribes, but this would depend on the frequency of G2c among the Pashtuns, since any Jewish genetic admixture in relatively recent times would have been limited in scope.

The Silk Road

The Medieval Silk Road, which extended from Sicily to Samarkand, the Hunza Valley, and on to Kaifeng, China.

The rarity of G2c in northeast Pakistan could indicate that G2c in this area originates outside the region and was brought there in the historic period from further west (this area was part of both the Achaemenid Persian Empire, conquered by Alexander the Great, and then formed a part of the Greco-Bactrian Kingdom). These two reported G2c haplotypes seem to be quite divergent from both the Ashkenazi Jewish clade and the lone northeastern Anatolian G2c based on only 10 Y-STRs, and therefore may not indicate a recent common origin. Another possible route which brought G2c to this region is through trade, because Hunza is a fertile valley that was a major stopping point along the southern Silk Road just before the Khunjerab Pass into China.

A Northern Near Eastern / South Caucasian origin for G2c is much more likely. The Turkish G2c haplotype, and 5 of 6 other almost certain G2c Armenian haplotypes have ancestors from a small region in Kars Province of Turkey near the Medieval capitals of Armenia. The rarity of G2c, which is limited to this small area which only became important after the year 884 is most likely due to G2c arriving in the region after this time.

Again, the Jewish areas of Kurdistan were not far from this same region. Haplogroup G has its greatest diversity in this same area, where all recorded sub-haplogroups of G have been found, so the evidence seems to point to this region of Eastern Anatolia or south of the Caucasus as the area of origin for all of haplogroup G as well. G2c could have spread from this region eastward toward the Hindu Kush and the Karakorum ranges, and southward among the Judeans, and then subsequently westward with the Jewish Diaspora to Italy and then Central and Eastern Europe. If the evidence shows that no Sephardi or Mizrahi Jews have G2c, then an origin with the Khazars of the Caucasus or another associated people who historically converted to Judaism during the Khazar Empire (c. 670-1017) although the particular regions where G2c is found in northeastern Anatolia and Armenia were never part of the Khazar Empire even at its greatest extent but always a part of Armenia.

Further avenues for research

More samples from Italy are very important. Also, deriving a tMRCA for all of European G2c, including Italy is crucial. One would expect that the tMRCA including Italy would be a bit further back than circa 1492, but so far there is no evidence for this. Confirming whether there are other Jewish G2c's that are not European, and then getting the tMRCA with these samples will indicate the immediate source of Ashkenazi Jewish G2c. Confirmation that the Armenian haplotypes are actually G2c is also needed. Then, finding more G2c's in the Kashmir region and calculating a tMRCA, with the Turkish G2c sample and the Jewish G2c's, would indicate the direction of the gene flow.

Famous people in haplogroup G2c

• John G. Cramer (b. 1934)

Physicist and author.

• James Franciscus (1934–1991)

Leading American film and television actor.

• Newton Minow (b. 1926)

Former Chairman of the United States Federal Communications Commission (FCC) and Chairman of the Public Broadcasting Service (PBS).

See also

• Haplogroup G (Y-DNA)
• Haplogroup G (Y-DNA) Country by Country
• haplotype
• Y-STR
• archaeogenetics
• genetic genealogy

References

External links

Sites

• Family Tree DNA Haplogroup G2c Project
• SMGF search for G2c haplotypes
• Haplogroup G SNP project
• Some Information and Theories on Haplogroup G

Maps

• Map of G
• Spread of Haplogroup G, from National Geographic
• The 2006 ISOGG Y haplogroup tree

Mailing Lists

• Haplogroup G2c discussion group
• Haplogroup G Yahoo Group
• Rootsweb Haplogroup G Mailing List
• Family Tree DNA's Haplogroup G2c Project
• FamilyTreeDNA's Haplogroup G Project

תבנית:Y-DNA